Science & Mathematics - 19 July 2007

2007-07-19 14:43:23 · 9 answers · asked by Pageepooh 2 in Astronomy & Space

2007-07-19 14:40:55 · 6 answers · asked by Cleveo7 1 in Astronomy & Space

2007-07-19 14:40:18 · 3 answers · asked by Cleveo7 1 in Astronomy & Space

2007-07-19 14:40:09 · 4 answers · asked by Brit 1 in Medicine

Where can I buy these power leads with the moulded plug?

2007-07-19 14:34:39 · 5 answers · asked by theoldmate800 1 in Engineering

I know how it works; it increases surface area and allows more neurons in less space, but why is an efficient method like this necessary? I mean, how is this an advantage? Why don't we just have big heads?

2007-07-19 14:30:13 · 4 answers · asked by Bombenhagel 3 in Biology

a) f(x) = (sec(x)(tan(x) +sec(x))) / (sec(x) + tan(x))

b) g(x) = [(x^2+1)/(x^2-1)]^(1/4)

what are the derivatives on these? any help would be great!

2007-07-19 14:24:51 · 1 answers · asked by Anonymous in Mathematics

2007-07-19 14:18:51 · 5 answers · asked by Anonymous in Physics

these are my top 3. Im not talking abut Friends and Family or Love or anything religious.

1. Music
2. Anime
3. CheeseCake haha.

2007-07-19 14:16:34 · 32 answers · asked by Anonymous in Other - Science

y = ln(x^7sin^2x)

help?

2007-07-19 14:16:18 · 2 answers · asked by Anonymous in Mathematics

2007-07-19 14:15:28 · 3 answers · asked by Angel V 2 in Biology

2007-07-19 14:14:03 · 2 answers · asked by Kym 1 in Chemistry

i know it has something to do w/ genetics, but whats the exact reason?

2007-07-19 14:12:46 · 12 answers · asked by tropicaltwist782 5 in Biology

Given the same outside temperature, and assuming you disregard the initial phase when the air conditioner is dehumidifying the room (assume the room is sealed), would the humid air be better at cooling the condenser coils?

2007-07-19 14:04:46 · 5 answers · asked by Anonymous in Physics

hows the weather where you are?

2007-07-19 13:59:42 · 15 answers · asked by Anonymous in Weather

Will it ever be possible to splice cat and bat genes, so that you have cats with bat wings? I don't care if the cats can fly or not, i just would like to see cats with batwings.

2007-07-19 13:58:22 · 2 answers · asked by Anonymous in Biology

2007-07-19 13:54:52 · 4 answers · asked by hedwig 2 in Astronomy & Space

I have heard some creationists say that dinosaurs never existed. How could you possibly believe that with all the facts we have?

I understand that people have faith, but allowing your faith to blind you from truth seems rather foolish to me.

2007-07-19 13:53:51 · 3 answers · asked by Anonymous in Biology

2007-07-19 13:48:48 · 4 answers · asked by hedwig 2 in Astronomy & Space

2007-07-19 13:48:22 · 11 answers · asked by JAMES 4 in Physics

Find the equations of both the tangent lines to the ellipse x^2 + 4y^2 = 36 that pass through the point (12,3).

y = (horizontal tangent line)
y = (non-horizontal tangent line)

any ideas?

2007-07-19 13:46:10 · 6 answers · asked by Anonymous in Mathematics

What kind of magnets could pick up 100kg or more? And where would one get them? (I dont know a lot about particular magnets so I cant go into specifics)

2007-07-19 13:36:21 · 4 answers · asked by ntm495 4 in Physics

3. Assume that you are a dealer in PC and have hired a new sales agent for a 2-week trial period. At the end of the two weeks, you must decide either to release him or place him permanently on the payroll. Based upon past experience, you estimate that given your prospective sales agents’ experience, personality and other traits, there is a 20 percent probability he will be a superior sales agent, a 70 percent probability he will be an average sales agent, and 10 percent probability that he will be an inferior sales agent. A superior sales agent is one who sells a PC to 40 percent of his customers, an average sales agent sells to 30 percent of his customers, and an inferior sales agent sells to 20 percent of his customers. After the 2-week period, you note that he has demonstrated PC to a total of 20 customers and has sold PC to 8 of them. Based upon all the information you have, should you retain the man permanently in your employment if your policy is to employ only average or su

2007-07-19 13:36:12 · 3 answers · asked by bhen 3 in Mathematics

1) 20 4/9
- 12 5/9

2) 6/21 x 3

3) 3 ÷ 4/5

4) 13 - 7/8

5) 4 3/4 x 8/12

6) 7/10 ÷ 2 1/3

7) 1/7 x 1/6

8) 5/11 ÷ 5/2

9) 2/3 ÷ 3

10) 1 1/8 ÷ 3/3

11) 1/2 x 3/8

12) 3/5 ÷ 1/5

13) I painted 1/5 of my house this weekend and 2/5 last weekend. How much have I painted?

2007-07-19 13:30:18 · 4 answers · asked by Kevin. 2 in Mathematics

could you describe the path of a molecule of water in detail as it is absorbed from the ground through the leaves of a tree into the atmosphere?

2007-07-19 13:27:52 · 3 answers · asked by K C M J 3 in Botany

Hello, I know this is a hard question to understand because I don't know how to really present it. So pleae bare with me.

I curious in learning more about mechanics but not nessarly in the field of auto mechanics. But more around the lines of using compents like gears, cranks, shafts, etc to build things that can function once all the peices are put in place.

I don't know what this would be called and perhaps someone else may know? I know it's mechanics but is there a more scientific name to it?

Thanks.

I'm hoping someone in the physic section of yahoo answers could give me some names or terms to use for a search. Thanks.

2007-07-19 13:27:32 · 3 answers · asked by Anonymous in Physics

I wonder....is our universe real? I mean, what if it all an illusion?
What if this is all a simulation of some sort? If not, is our world an alternate version of another universe or world? Perhaps its a smaller version of something bigger...
Your opinion please.

2007-07-19 13:23:14 · 13 answers · asked by BluesMD 1 in Astronomy & Space

TACTGCTGCAGCCAGCCGACTAAATAG

If a mutation occured in the DNA above in which a Cytocine was switched to a Guanine, which would cause the greatest change in the protein encoded by this section of DNA - if the first Cytocine is changed or if the second Cytocine is changed. You must properly explain your answer to recieve credit.

2007-07-19 13:23:09 · 4 answers · asked by intoxicatedturtle 4 in Biology

First number is twice as large as the third.
First number and the third number are equal to the second number.
Half of the second number and the whole of the third equals the first number.

2007-07-19 13:21:24 · 3 answers · asked by MathBoy 2 in Mathematics

2007-07-19 13:15:31 · 3 answers · asked by Michael P 1 in Physics