TACTGCTGCAGCCAGCCGACTAAATAG
If a mutation occured in the DNA above in which a Cytocine was switched to a Guanine, which would cause the greatest change in the protein encoded by this section of DNA - if the first Cytocine is changed or if the second Cytocine is changed. You must properly explain your answer to recieve credit.
2007-07-19 13:23:09 · 4 answers · asked by intoxicatedturtle 4 in Science & Mathematics ➔ Biology
If the first cytosine is changed, then the first triplet in the DNA says TAG instead of TAC.
-- TAG is transcribed to AUC of the mRNA strand. AUC calls for the amino acid isoleucine, according to the mRNA codon chart here: mhtml:http://brv.k12.in.us/High%20School/Departments/Science/Adamczyk/Biology%20Files/Universal%20RNA%20Codon%20Chart.mht
-- TAC of DNA transcribes to mRNA's AUG. AUG calls for methionine.
If the second cytosine is changed, then the second triplet in the DNA says TGG instead of TGC.
-- TGG in DNA becomes ACC in mRNA, calling for the amino acid threonine.
-- TGC in DNA becomes ACG in mRNA, calling for the amino acid threonine.
Now you can see which causes a change in the protein.
2007-07-19 13:37:44 · answer #1 · answered by ecolink 7 · 1⤊ 0⤋
Well if the first cytocine was changed to a guanine it would create a stop codon, and thus the sequence would be done translating, so I would have to say it would be pretty significant.
2007-07-19 20:34:06 · answer #2 · answered by Greg 3 · 1⤊ 0⤋
You mean your teacher wants YOU to properly explain your answer. How are you going to explain your answer?? "UH..I got it off yahoo?"
2007-07-19 20:58:34 · answer #3 · answered by bronte heights 6 · 0⤊ 1⤋
it's good to do your own research.. you learn more that way...
but look up the wobble hypothesis.
2007-07-19 20:39:10 · answer #4 · answered by Anonymous · 1⤊ 1⤋