Science & Mathematics - 18 July 2007

They take any hidrocabons,like plastic and use microwaves to turn it back in to oil to make gasoline.

2007-07-18 14:27:52 · 6 answers · asked by scott p 5 in Chemistry

Consider the following data that show temperature of a 1,000 g sample of water at normal atmospheric pressure as a function of heat supplied. A kJ can simply be thought of a unit of heat.


Temperature Heat Supplied
0 oC 0 kJ
10 oC 42 kJ
30 oC 126 kJ
50 oC 209 kJ
80 oC 335 kJ
99 oC 414 kJ
100 0C 420 kJ

Based on these data, please supply the following:
1. Provide a graph of the data. Is the graph sufficiently linear to allow prediction of heat supplied versus temperature in the range of 0–100 oC?
2. If so, use Microsoft Excel to provide an equation that relates heat, y, supplied to temperature, x, in the range of 0–100 oC.
3. Are the results consistent with the expected equation, heat = (1.00 cal/g oC) * mass in grams * (final temperature – initial temperature)?

Can anyone help me with this? I have no idea what to enter as the equation to get Excel to have something to work with.

2007-07-18 14:26:14 · 4 answers · asked by Stumped 4 in Mathematics

How can you find the number of possible outcomes of a playoff between 2 teams where the first team that wins 4 games wins the playoff???

2007-07-18 14:22:56 · 2 answers · asked by E 1 in Mathematics

Any ideas to solve this animal? Thanks!

*Obviously the power only applies to (x+1)

2007-07-18 14:21:37 · 5 answers · asked by Jorm 3 in Mathematics

sure you have to work hard to get you goals! i always had a wish to become a doctor and i am not that rich! so my question is that can i go to the community college for four years and then if i will apply to medical student will they accept me? my problem is that i don't have much money and i can't leave my parents because they can't speak English and my grandma is very sick!its not good idea to leave my grandma and parents like that!
so my question if i will go to community college for 4 years will they accept me for medical school?
thank you very much

2007-07-18 14:20:05 · 4 answers · asked by Anonymous in Medicine

original number at the end of 20 days

2007-07-18 14:18:42 · 2 answers · asked by mario neil m 1 in Mathematics

Ive been on 16mg Suboxone for 2 years now and I havent touched anything.Should I feel proud of my self or am I still an addict?I dont even hang out with any of my old friends..

2007-07-18 14:17:04 · 1 answers · asked by Jonathan M 2 in Medicine

rule 10

f(x) = b^g(x)
then
f ' (x) = b^g(x) x ln b x g ' (x)

rule 11
f(x) = e^g(x)
then f ' (x) = e^g(x) x g ' (x)

i just wanted to know wheter the variable b and the variable e have a reason why they are that way or b and e are just the same. because i have to answer this problem and i dont know which one to use :s.

2007-07-18 14:13:50 · 2 answers · asked by Matt Jillian 2 in Mathematics

please help

2007-07-18 14:13:44 · 3 answers · asked by ambi565 2 in Geography

How exactly is it possible to tell which way is North South East and West from the point where we're standing without looking at the map? I know it's easy to figure out the rest of it once we know where North is but how do we find where North is?

2007-07-18 14:10:26 · 10 answers · asked by smriti_abhinav 1 in Geography

2007-07-18 14:10:12 · 9 answers · asked by Anonymous in Earth Sciences & Geology

what is the answer if you get it right i might make it the best answer. 23+5612-1234+7897x4562+4554=?

2007-07-18 14:09:00 · 11 answers · asked by Anonymous in Mathematics

2007-07-18 14:08:02 · 2 answers · asked by lyttle-lee j 1 in Mathematics

Is it winter already here? It has started raining already..

2007-07-18 14:04:01 · 5 answers · asked by Indie Macbeth 1 in Weather

Sorry if this is the wrong area for this. Where can I find pictures of plants, especially vines, that are promanint in the rainforests. The geography of the plant doesn't matter. I'll also search myself, but as I said in prior questions, I'm not a good Googler.

2007-07-18 14:01:16 · 3 answers · asked by Amanda G 2 in Botany

2007-07-18 14:00:09 · 8 answers · asked by zipperip 1 in Botany

2007-07-18 13:53:19 · 1 answers · asked by Anonymous in Earth Sciences & Geology

Factor.
1) 784

2) 576

3)√ 675

4) PLEASE EXPLAIN. WHY CAN'T I TAKE 784/2 and /2???

5) Can I take √675 and divide 675/4=???

2007-07-18 13:47:53 · 10 answers · asked by Anonymous in Mathematics

Please explain why you may tink this way?

2007-07-18 13:46:42 · 15 answers · asked by Anonymous in Astronomy & Space

Question:

If each group of numbers consist of six numbers,

the first five numbers may range between (1-36)

Whereas, the “S” or Superior number may range between the numbers (1-10)

Use the following numbers to determine the next group of numbers.

1, 7, 18, 19, 27 - S: 4

4, 7, 9, 14, 26 - S: 5

7, 9, 24, 32, 36 - S: 7

5, 12, 13, 16, 27 - S: 9

5, 7, 9, 22, 24 - S: 7

2, 3, 21, 25, 34 - S: 8

18, 28, 29, 34, 36 - S: 2

1, 14, 15, 25, 35 - S: 6

8, 14, 24, 30, 31 - S: 10

2007-07-18 13:46:06 · 3 answers · asked by justin j 2 in Mathematics

inside a conducting spherical shell (b). The shell has inner radius 1.7 cm, outer radius 4.2 cm, and a net charge 25.9 pC.
Q' = charge on inner surface of shell
Q'' = charge on outer surface of shell
Find:
a) Q''
b) magnitude of electric field of a point P midway between the sphere and the inner part of the shell
c) potential of P assuming potential at r = infinity is 0

This is what I've done:
a) Q'' = Q_a + Q_b = (-1.6 pC) - (25.9 pC) = -27.5 pC

b) E = Q_a/((4)(pi)(r^2)(e_0))
r = (r_a + r_b)/2 = ((0.6 cm) + (1.7 cm)) = 1.15 cm = 0.0115 m
E = (-1.6E-12 C)/((4)(pi)((0.0115 m)^2)(8.85E-12 C^2/Nm^2)) = -3.996E2 N/C

c) V = V_p - V_c
V_c = outside of shell
r_p = radius of P
r_c = outside radius of shell
V_p = V + V_c
V = -(k)(Q_a)(1/r_p)(1/r_c)
V_c = (k)((Q_a) + (Q_b))/(r_c)
V_p = -(k)(Q_a)(1/r_p - 1/r_c) + (k)((Q_a) + (Q_b))/(r_c) = (8.988E9 Nm^2/C^2)(-1.6E-12 C)(1/(0.0115 m) - 1/(0.042 m)) + (8.988E9 Nm^2/C^2)((-1.6E-12 C) + (25.9E-12 C))/(0.042 m) = 6.108 V
But the units don't add up

2007-07-18 13:44:56 · 3 answers · asked by Anonymous in Physics

2007-07-18 13:39:30 · 7 answers · asked by Dimitri VanHorn 1 in Medicine

I'm trying to find the area using left endpoint evaluation but i keep getting the answer wrong!

1) y = x^2 on [ -1,1 ]
n = 8 (number of rectangles)

so I find deltaX = ( 1 - (-1)) / 8 = .25

I now make a table, X values on left, f(x) values on right

Xo = 0 , 0
X1 = .25 , .0625
X2 = .5 , .25
X3 = .75 , .5625
X4 = 1 , 1
X5 = 1.25 , 1.5625
X6 = 1.5 , 2.25
X7 = 1.75 , 3.0625
X8 = 2 , 4

* f(x) values are found by plugging in X into y = x^2

I add f(x0) + f(x1) + .. (fx7) and get 8.75

To find the area, I must multiply 8.75 by deltaX (.25)..I get 2.1875. The answer in the back of my book says 0.6875.

Are my calculations wrong?

2007-07-18 13:36:43 · 3 answers · asked by sky l 1 in Mathematics

Judy places 0.150 kg of boiling water in a thermos bottle. How many kg of ice at -12.0 C must Judy add to the thermos so that the equillibrium temperature of the water is 75C?

2007-07-18 13:34:55 · 2 answers · asked by Anonymous in Physics

I was watching MTV Cribs and some people had elevators in their homes. Can they get stuck in them? Are they power operated?

2007-07-18 13:34:04 · 6 answers · asked by Anonymous in Engineering

2007-07-18 13:32:27 · 11 answers · asked by Anonymous in Other - Science

State the order of amino acids when the sequence of bases (nucleotides) in DNA is:

TACTGCTGCAGCCAGCCGACTAAATAG

2007-07-18 13:28:53 · 2 answers · asked by intoxicatedturtle 4 in Biology

i-e East/West/North/South.

2007-07-18 13:28:48 · 15 answers · asked by haya 2 in Astronomy & Space

2007-07-18 13:28:10 · 2 answers · asked by Foto Freek 2 in Zoology

{5x-2y=4
{3x+y=9

{5x-2y=4
{-2(3x+y=9)

{5x-2y=4
{-6x-2y=-18
+________
-x = -14
Wel... by then I realize its wrong.... The answer is supposed to be (2,3) but i dont see what I can be doing wrong, Plz show me I dont wanna get stuck and desperate like the last two nights....

2007-07-18 13:22:05 · 10 answers · asked by Poseidon 2 in Mathematics