Science & Mathematics - 2 January 2007

Find the solution to the equation

a. no solutions

b. a = 4/3

c. a = 100/3

d. a = 20

2007-01-02 15:25:04 · 14 answers · asked by KCoop01 1 in Mathematics

2007-01-02 15:24:48 · 3 answers · asked by Anonymous in Chemistry

if a sunflower seed is placed in one's butt, either accidentally or otherwise, will it grow?

2007-01-02 15:22:14 · 13 answers · asked by Twsti07 2 in Botany

(4,-2),(6,3),(4,2),(5,4)

Is the set of ordered pairs shown above a function?

2007-01-02 15:22:06 · 7 answers · asked by KCoop01 1 in Mathematics

Simplify the expression by distributing and collecting like terms!

a.2x – 8

b. 2x – 4

c. 2x + 8

d. 6x – 8

2007-01-02 15:20:55 · 17 answers · asked by KCoop01 1 in Mathematics

2007-01-02 15:20:43 · 7 answers · asked by Anonymous in Biology

a. 4+ 0= 4

b. 4 x 0= 0

c. 4/1 x 1/4 = 1

d. 4 x 1= 4

2007-01-02 15:19:55 · 7 answers · asked by KCoop01 1 in Mathematics

Which of the following is the term for a human cell that contains 22 pairs fo autosomes and two X chromosomes?
a. an unfertilized egg cell
b. a female somatic cell
c. both a and b

2007-01-02 15:19:38 · 3 answers · asked by lauren u 1 in Biology

Do you believe creator of universe?
If yes, where are creator? inside universe or outside universe?
Are heaven and hell part of universe? If no, where are heaven and hell?
Is creator (God) in heaven? Then, who create heaven?
If God create heaven, then where are creator before heaven created?

If there is no creator in universe, then why there are big bang?
From where all the energy coming? Suddenly appear???

2007-01-02 15:18:33 · 6 answers · asked by seah 7 in Astronomy & Space

2007-01-02 15:17:47 · 3 answers · asked by Anonymous in Earth Sciences & Geology

Like, a cat and a bat are nocturnal and we are the opposite. What's the term for those that reside in the daytime?

2007-01-02 15:17:27 · 15 answers · asked by Smo 4 in Biology

2007-01-02 15:16:55 · 7 answers · asked by Zoid00 2 in Biology

2007-01-02 15:16:33 · 8 answers · asked by 1stbasesox@sbcglobal.net 1 in Botany

like a sheet of super white paper is whiter than ur ordanary run of the mill paper and ur new black shirt is probably darker than ur black jacket ; what would be the whitest thing and blackest thing in normal light conditions(outside or inside with a light bulb)

2007-01-02 15:16:29 · 11 answers · asked by Anonymous in Chemistry

okay, so my biology teacher gave us this sheet and it explains the DNA replication. it says..
3' 5'
CGCTACTCTACGGCACCCAATATTACGTAGTCCTTGGGGGTTTAACGGTACCCAGTATCCGGCCT
GCGATGAGATGCCGTGGGTTATAATGCATCAGGAACCCCCAAATTGCCATGGGTCATAGGCCGGA
5' 3'

and the assignment is to create a DNA replication study sheet using this sequence.
and i am confused.
please help!!! i will be greatly obliged.
thanks.

2007-01-02 15:14:02 · 2 answers · asked by whattup. 1 in Biology

2007-01-02 15:13:18 · 6 answers · asked by Anonymous in Biology

Find the solution to the equation.



a. x = 13


b. x = -7


c. x = -15

d. x = -13

2007-01-02 15:13:16 · 12 answers · asked by Gloria T 1 in Mathematics

so i started out using the equation f'(c) = [ f(b) - f(a) ] / (b - a) and ended up with 3x^2 - 6x + 2 = 0. then im lost.

2007-01-02 15:10:13 · 2 answers · asked by dizzawg16 3 in Mathematics

2007-01-02 15:09:32 · 6 answers · asked by Marthie R 1 in Zoology

Use the function shown above to find the value of g(0).

2007-01-02 15:06:50 · 8 answers · asked by soccergrl8128 1 in Mathematics

of 24 28 9 12 16 42 63

2007-01-02 15:06:26 · 8 answers · asked by Anonymous in Mathematics

is oil an example of a saturated fat???
thanks

2007-01-02 15:06:16 · 2 answers · asked by hondarider400at 3 in Biology

Use the function shown above to find the value of f(-2).

2007-01-02 15:04:16 · 10 answers · asked by soccergrl8128 1 in Mathematics

A college student pays $280 for a three hour course. How much would he have to pay for a class load of 16 hours? Round your answer to the nearest whole dollar. Be sure to put a dollar sign ($) on your answer.

2007-01-02 15:03:08 · 7 answers · asked by soccergrl8128 1 in Mathematics

2007-01-02 15:02:22 · 7 answers · asked by Anonymous in Mathematics

What are the gravitational effects, if any, of the immense (possibly
infinite) vacuum energy density seemingly predicted by quantum field
theory? Is it really that huge? If so, why doesn't it act like an
enormous cosmological constant?

2007-01-02 15:02:09 · 3 answers · asked by Anonymous in Physics

2007-01-02 15:01:21 · 32 answers · asked by Doma B 1 in Mathematics

Can you please show it STEP by STEP!

2007-01-02 15:00:45 · 4 answers · asked by ٭I Love The LORD!٭ 2 in Mathematics

If there were no truth to this, why would my postings about Jesse Dirkising and other statistics which prove this very fact keep getting deleted without cause???
"First, we can expect an eventual end to any structural prerequisites for a legitimate sexual relationship. The whole “gay marriage” debate is predicated on the assumption that affective bonds trump the structural argument from Scripture and nature for an other-sex prerequisite. What logical basis will remain for denying marriage to committed sexual unions comprised of three or more persons? In fact, the limitation of two persons in a sexual union at any one time is itself predicated on the idea that two sexes are necessary and sufficient for establishing a sexual whole. Once church and society reject a two-sexes prerequisite, there will be no logical ground for maintaining the sacredness of the number two in sexual relations. It is not surprising that litigants in polygamy cases in Utah and Arizona are now applying the

2007-01-02 14:58:01 · 26 answers · asked by Lovin' Mary's Lamb 4 in Other - Alternative

2007-01-02 14:54:47 · 9 answers · asked by Anonymous in Mathematics