Biology - February 2007

2007-02-19 08:07:44 · 7 answers · asked by Tanya 2

2007-02-19 08:03:22 · 1 answers · asked by gotempleowlssjw 2

My teacher mentioned a few things in class, but I want to know why a virus is considered living or non-living.

2007-02-19 07:42:54 · 17 answers · asked by crystalgoddess101 1

2007-02-19 07:03:42 · 17 answers · asked by melissa 5

Is beginning a family at age 29-30 too late? What are the risks? Medical professionals, please respond!

2007-02-19 06:49:03 · 15 answers · asked by christian_mennonite_pacifist 3

2007-02-19 06:48:39 · 6 answers · asked by Anonymous

a) 61 code for an amino acid and 3 are stop codons
b) all of them code for atleast one amino acid.
c) 20 code ofr 2 amino acids and the rest code for a single amino acid.
d) 2 are start codons and 3 are stop codons and 59 code for a single amino acid.

2007-02-19 06:36:33 · 4 answers · asked by ? 2

a) 180 amino acids long
b) 60 amnino acids long
c) 20 amino acids long
d) 10 amino acids long.
this is from a biology worksheet does anyone know where to find this worksheet online?

2007-02-19 06:32:55 · 2 answers · asked by ? 2

2007-02-19 05:17:36 · 5 answers · asked by pocket_angel04 1

11) Explain how both genes and the environment determine how tall a person will be.

16) Explian why traits controlled by recessive alleles on the X chromosomeare more common in males than in females.

17) How is the sickle-cell disease inherited?

25) Explain how a horse breeder might use selective breeding to producehorses that have golden coats.

37) DEscribe how gene therapy might be used in the future to treat a person with hemophilia.

2007-02-19 05:13:02 · 5 answers · asked by Right here Right now 1

Which statement best describes the expected resulting a typical cell is placed into fresh water?

a) Active transport of watter into the cell would begin
b) there would be a net movement of watter out of the cell
c) There would be a net movement of watter into the cell
d) protine synthesis would begin
e)no change in the cells watter content would occur

2007-02-19 04:39:10 · 5 answers · asked by dancing_diva 2

2007-02-19 04:36:29 · 10 answers · asked by John 1

2007-02-19 04:31:56 · 2 answers · asked by Anonymous

is this an example of a nonsense frameshift mutation if the nucleotide 25 (G) in the DNA template is deleted?

dna template:
3' aattcgttcttctacgtagctctcgattgcgagatcagaaaagttttttgacttttatgcat 5'

mRNA transcript:

5' uuaagcaagaagaugcaucgagaccuaacgcucuagucuuuucaaaaaacugaaaauacgua 3'

amino acids:

leucine, serine, lysine, lysine, methionine, histidine, arginine, aspartic acid, leucine,threonine, leucine, stop codon, serine, phenylalanine, glutamine, lysine, threonine, glutamic acid, asparganine, threonine


with 25 (G) deleted

5' uuaagcaagaagaugcaucgaaccuaacgcucuagucuuuucaaaaaacugaaaauacgua 3'

amino acids:

leucine, serine, lysine, lysine, methionine, histidine, arginine, threonine, stop codon, arginine, serine, serine, leucine, phenylalaline, lysine, lysine, leucine, isoleucine, glycine

2007-02-19 04:08:18 · 1 answers · asked by Cynthia P 1

2007-02-19 04:04:41 · 7 answers · asked by mehul p 1

Ok. I missed class last week due to personal reasons. Anyways, I missed the section on how to code strands of DNA. I go to OSU, so of course my professor wouldnt be able to help me since theres over 400 people in the class and I don't know anyone else taking this class.

Anyways, we got a worksheet to do with 3 questions. I read in my book on how to do this, but I don't understand it.

The questions we got were:

The following nucleotide sequence is the coding strand of DNA:
ATG ACT TGT GTC CTA TAG

Please provide the sequence of the template strand.

Please transcribe the mRNA from this DNA.

Please translate the amino acid sequence from this message.


Can anyone help me out? And perhaps, give me a short summary on how to do this?

2007-02-19 03:50:19 · 6 answers · asked by GoBuckeyes! 3

Who used a classification scheme that did NOT sort homology from analogy?

A) Carolus Linnaeus
B) Charles Darwin
C) Matoo Kimura
D) both A and B
E) both B and C

2007-02-19 03:30:49 · 2 answers · asked by SonRK 2

2007-02-19 03:21:20 · 5 answers · asked by greymair_1 1

2007-02-19 03:12:31 · 4 answers · asked by Anonymous

how does and itch start and what is it from a biological and scientific point of view scientifically and biologically what is an itch and how does it start

2007-02-19 02:44:10 · 2 answers · asked by JAY 1

2007-02-19 02:44:06 · 3 answers · asked by MisterMeToo 1

A brown eyed man is married to blue eyed women. They have one child with blue eyes. What is the
(A) genotype of man
(B) genotype of woman
(C) genotyp of blue eyed child
(D) gamete probability of man
(E) probobility of next child having brown eyes

2007-02-19 02:36:38 · 11 answers · asked by Kelly C 1

2007-02-19 02:35:46 · 1 answers · asked by amateurgrower 3

If we evolved from apes/monkey's/primates, how come monkeys, etc. are still present on earth? (I'm not trying to disprove evolution, I'm just curious)

2007-02-19 02:31:37 · 7 answers · asked by D$ 2

2007-02-19 02:25:27 · 4 answers · asked by amateurgrower 3

2007-02-19 02:25:06 · 7 answers · asked by Doyin 1

enzymes have various applications in industry..one of the industry is pharmaceuticals...apart from therapeutic agents what are their other uses?

2007-02-19 02:07:24 · 2 answers · asked by shipra g 2

2007-02-19 01:55:27 · 2 answers · asked by smashbrolover 1

2007-02-19 01:55:14 · 8 answers · asked by dulc_richardson 1

2007-02-19 01:49:20 · 2 answers · asked by naomisherrie 1