transciption translation?

Question

is this an example of a nonsense frameshift mutation if the nucleotide 25 (G) in the DNA template is deleted?

dna template:
3' aattcgttcttctacgtagctctcgattgcgagatcagaaaagttttttgacttttatgcat 5'

mRNA transcript:

5' uuaagcaagaagaugcaucgagaccuaacgcucuagucuuuucaaaaaacugaaaauacgua 3'

amino acids:

leucine, serine, lysine, lysine, methionine, histidine, arginine, aspartic acid, leucine,threonine, leucine, stop codon, serine, phenylalanine, glutamine, lysine, threonine, glutamic acid, asparganine, threonine


with 25 (G) deleted

5' uuaagcaagaagaugcaucgaaccuaacgcucuagucuuuucaaaaaacugaaaauacgua 3'

amino acids:

leucine, serine, lysine, lysine, methionine, histidine, arginine, threonine, stop codon, arginine, serine, serine, leucine, phenylalaline, lysine, lysine, leucine, isoleucine, glycine

Answer 1

The change in the sequence is before the stop-codon, so this will lead to a "false" protein sequence, as the deletion leads to a different amino acid sequence.

If it had occured after the stop-codon, it would probably not be a nonsense mutation.