Biology - July 2007

2007-07-18 16:14:29 · 8 answers · asked by paladius 1

what is/are the unique cell type that is used by organisms in the phylum Cnidaria for protection/trapping food?
and how this cell functions (detail)??

2007-07-18 15:38:04 · 4 answers · asked by FISH 1

...extremely small, medium,and very long.These birds feed primarily on insects to trees and dirt requiring the beaks to workout the insects.A major freeze during the winter has killed off many of the insects in the topsoil this bird naturally feeds on so they are left with their prey that live in the nearby warmer trees.The birds with the largest beaks have the advantage of having acces to these "hard reached" insects and change the gene pool of this species due to their perpetuation and the loss of the birds whom could not reach their only food source.
1.which is the type of natural selection exibited in this example?
a.stabilizing b.directional c.extreme d.disruptive e.none of the above
2.in the next generation the offspring will primarily consistof individuals with what relative size of beaks?
a.none b.small c.medium d.large e.they all died
3.The new stress on this organism in it's environment is what?
a.pollution b.new predator c.excessive hunting d.loss of major food source

2007-07-18 15:22:35 · 4 answers · asked by lal m 1

phylum cnidaria

2007-07-18 15:15:44 · 4 answers · asked by Anonymous

Australian Biologist??

2007-07-18 15:06:48 · 11 answers · asked by kick_it_again 2

I want to know the relationship that gives rise to lichens. and i want to name all of the members of the relationship, and explain what each gets/gives to the system.?

2007-07-18 15:03:32 · 3 answers · asked by FISH 1

Yuhp. its for my science project. . =]

2007-07-18 14:42:15 · 4 answers · asked by Anonymous

...extremely small, medium,and very long.These birds feed primarily on insects to trees and dirt requiring the beaks to workout the insects.A major freeze during the winter has killed off many of the insects in the topsoil this bird naturally feeds on so they are left with their prey that live in the nearby warmer trees.The birds with the largest beaks have the advantage of having acces to these "hard reached" insects and change the gene pool of this species due to their perpetuation and the loss of the birds whom could not reach their only food source.
1.which is the type of natural selection exibited in this example?
a.stabilizing b.directional c.extreme d.disruptive e.none of the above
2.in the next generation the offspring will primarily consistof individuals with what relative size of beaks?
a.none b.small c.medium d.large e.they all died
3.The new stress on this organism in it's environment is what?
a.pollution b.new predator c.excessive hunting d.loss of major food source

2007-07-18 14:33:49 · 5 answers · asked by lal m 1

State the order of amino acids when the sequence of bases (nucleotides) in DNA is:

TACTGCTGCAGCCAGCCGACTAAATAG

2007-07-18 13:28:53 · 2 answers · asked by intoxicatedturtle 4

2007-07-18 12:00:12 · 5 answers · asked by Lewis N 1

saprotrophs secrets enzymes on to the organic matter ?in this line what is meant by ON TO THE ORGANIC MATTER?the organic matter of what ?

2007-07-18 11:08:13 · 4 answers · asked by Anonymous

2007-07-18 10:58:12 · 7 answers · asked by Anonymous

a) monkeys
b) humans
c) apes
d) humans and apes only.
e) monkeys, humans, and apes.

2007-07-18 10:38:41 · 5 answers · asked by Anonymous

Cloned a cat for a lot of money. If they can clone a cat why cant they clone this mammoth once?

2007-07-18 09:47:48 · 12 answers · asked by <33 : ) : D <33 2

i'm into drinking more water is that helpful?

2007-07-18 09:35:28 · 3 answers · asked by Anonymous

Before a cell can divide, its genetic information, must be copied.
A.true
B.false

2007-07-18 08:50:56 · 4 answers · asked by Anonymous

A. Measuring
B. Analyzing results
C. Relying on personal opinion to make conclusions
D. Making observations
E. Forming hypotheses

2007-07-18 08:10:27 · 16 answers · asked by Anonymous

A. Genetic analysis
B. Photographs
C. Fossil records
D. Changes in one generation
E. Biochemical studies

2007-07-18 07:57:41 · 9 answers · asked by Anonymous

I've been told that E. coli's circular chromosome has 4.6 million base pairs. If the entire chromosome were expanded, as when a cell is lysed, and all kinks and twists were removed, how long would it be in centimeters or inches?

2007-07-18 07:41:19 · 1 answers · asked by plentino 1

2007-07-18 07:31:17 · 3 answers · asked by Gaba a 1

2007-07-18 07:29:16 · 5 answers · asked by Anonymous

2007-07-18 07:19:04 · 4 answers · asked by G.xi 1

I took this photo a few weeks ago in N.W. Arkansas and I can't seem to find this dragonfly in any field guides.

Any help would be appreciated.


http://i132.photobucket.com/albums/q3/deanreevesi/unknown_for_bucket.jpg

2007-07-18 07:18:32 · 1 answers · asked by Anonymous

2007-07-18 05:56:06 · 5 answers · asked by Sanawar N 2

2007-07-18 05:49:51 · 15 answers · asked by Calchas 3

A) are often linked to changes in day length
B) rely solely on endogenous cues
C) involve foraging, reproduction, and migration
D) do not occur in free-running conditions

THANKS

2007-07-18 05:20:02 · 2 answers · asked by hello 1

If someone's going to get bitten, it's me. Do some people have a type of blood chemistry or temperature which makes them more likely to get bitten? Any biologists with a scientific explanation welcome, thanks.

2007-07-18 05:13:19 · 10 answers · asked by Shona L 5

how does it relates and differ from each other between man and wonmen,, how does it relates

2007-07-18 04:57:40 · 1 answers · asked by amara_359 1

I have no idea bout this..

2007-07-18 03:47:17 · 14 answers · asked by AriANe 1

The building blocks of life are ________.

2007-07-18 02:07:41 · 12 answers · asked by ♥Anonymous♥ 2