Biology - July 2007

What do you think about him and his books?

2007-07-20 10:09:34 · 10 answers · asked by Jonathan H 2

I ws sitting outside my office building a few minutes ago and this giant black bug kept trying to take swipes at my head. It was approximately 1 1/2 inces to 2 inches long. It's wings resemebled the shape of a common house fly, except they were all solid black and not at all tranlucent. It had an oval shaped head that looked like it had two tiny eyes on either side. It also had a grey oval patch on the top part of it's head - I don't remember if it overlapped it's eyes. By the size and looks of it it looked like it weighed alot for a bug, kind of beelte like even though it's wings were not shells, they did have a thickness to them. I did not see it's undeside very well, but from when it was flying I could tell it was almost completely if not completely black.

I looked at various species of cicadas but could not find one that matched what I saw - most had transparent wings and were ovalish. Can someone tell me what this is??? please...

2007-07-20 07:34:42 · 3 answers · asked by Anonymous

i got everything, and i mean every single thing from my dad's side of the family. body, height, face, color, personality. my dad is a print of his dad and im a print of my dad's. people say im a female version of him, but prettier. And the one thing i did not get, was my grandfather's green eyes. neither did my dad. why did this happen??

2007-07-20 07:21:24 · 12 answers · asked by ♥ 4

2007-07-20 06:38:29 · 6 answers · asked by B 3

2007-07-20 06:36:55 · 7 answers · asked by John B 1

Muscle Contraction and pizza??
I want to draw muscle contraction relating it to pizza, how could i do this while including the following steps? like how do i change these steps into 1. putting chesse on the pizza..just as though it was muscle contraction happening like a comic strip of muscle contraction through pizza any ideas??
1. ACH released and binds to recepto on muscle fiber
2. Membrane depolarized with T-tubule help, calcium released from SR into muscle fiber
3. T and T bind Ca, actin release
4. Actin/myosin bind (ATP) until fully conctracted (cross-bridging has occurred)
5. ACHase removes ACH from receptors
6. Calcium is returned to SR (ATP)
7. Actin and myosin releae (ATP), muscle relaxes
8. T and T move back in to bind actin

2007-07-20 06:20:11 · 3 answers · asked by BiologyQuestions 3

The process in which live incoated bacteria had acquired the ability to make coats from the dead coated strain is called_________.
A. process reformation
B.process transformation
C.process replication
D.none of the above

2007-07-20 06:16:25 · 6 answers · asked by cherryvalley2006 2

(mention all the three conditions)

2007-07-20 05:25:16 · 5 answers · asked by Gladson D 1

Why do animals have sex for creation and humans for their desire? Every time an animal have sex they create but humans don't why?

2007-07-20 05:05:14 · 8 answers · asked by SheisShe 1

2007-07-20 04:23:19 · 7 answers · asked by Humaira Khan 2

possible that their could be a link up to a pump to feed blood & oxygen to the head to keep it alive ready for atransplant in other words head keept alive on the shelf it not such a bad thought try to explain how this could be done

2007-07-20 03:33:51 · 3 answers · asked by david p 3

2007-07-20 02:45:00 · 3 answers · asked by kishma h 1

2007-07-20 01:19:53 · 6 answers · asked by kishma h 1

I know that Bromides are excreted through the skin as well as urinary, and i wanted to know if Iodides/Iodine are excreted the same way as they are both halides. Is this the same as in felines?

2007-07-19 22:21:24 · 2 answers · asked by Anonymous

2007-07-19 19:55:23 · 7 answers · asked by Jon 1

I am 14 years old and I have always had a dream to be a marine biologist. I was just wondering what might make that happen and what I would need to do. Sometime I would like to go to college in Australia maybe and study around the reef. I'm very interested in Cetaceans and other marine mammals.

2007-07-19 19:30:08 · 5 answers · asked by Kay 2

2007-07-19 17:19:34 · 7 answers · asked by Anonymous

2007-07-19 17:18:20 · 1 answers · asked by seira 1

I keep reading conflicting timelines for human evolution vs. dinosaur extinction. Can someone please explain.

2007-07-19 15:13:25 · 12 answers · asked by Anonymous

Why living organisms sex without the God who give this feelings ?

2007-07-19 15:08:02 · 15 answers · asked by Marlou G 1

2007-07-19 15:05:13 · 5 answers · asked by ginatay00 1

First right answer wins.........

2007-07-19 14:53:05 · 12 answers · asked by Duke 2

I know how it works; it increases surface area and allows more neurons in less space, but why is an efficient method like this necessary? I mean, how is this an advantage? Why don't we just have big heads?

2007-07-19 14:30:13 · 4 answers · asked by Bombenhagel 3

2007-07-19 14:15:28 · 3 answers · asked by Angel V 2

i know it has something to do w/ genetics, but whats the exact reason?

2007-07-19 14:12:46 · 12 answers · asked by tropicaltwist782 5

Will it ever be possible to splice cat and bat genes, so that you have cats with bat wings? I don't care if the cats can fly or not, i just would like to see cats with batwings.

2007-07-19 13:58:22 · 2 answers · asked by Anonymous

I have heard some creationists say that dinosaurs never existed. How could you possibly believe that with all the facts we have?

I understand that people have faith, but allowing your faith to blind you from truth seems rather foolish to me.

2007-07-19 13:53:51 · 3 answers · asked by Anonymous

TACTGCTGCAGCCAGCCGACTAAATAG

If a mutation occured in the DNA above in which a Cytocine was switched to a Guanine, which would cause the greatest change in the protein encoded by this section of DNA - if the first Cytocine is changed or if the second Cytocine is changed. You must properly explain your answer to recieve credit.

2007-07-19 13:23:09 · 4 answers · asked by intoxicatedturtle 4

can someone help me answer these questions...Im quite confused and could you please briefly explain it?

1. If offspring exhibit a 3:1 phenotypic ratio, what are the genotypes of the parents?

2. If the F2 generation consists of 90 long-winged flies to 30 vestivial-winged flies, what was the phenotype of the f1 flies?

and could you also explain in simple way what x-linked are?

2007-07-19 12:54:46 · 3 answers · asked by noidea 1

2007-07-19 12:22:12 · 4 answers · asked by Anonymous