Science & Mathematics - 22 November 2006

Please help me, thank you.?
I am 16 years old this year and i really want to know the way to study. I know that study is important for me but whenever i open the books then i will feel sleepy. Sometimes i after i study , the next morning i will forgot what i read yesterday. I really hope that i can study well but i cant. Please teach me the tips to study, thank you very much. My ambition is to becoming an engineer but im not clear about my ambition and i dont even know what an engineer need to study and do.I scare i choose the wrong ambition. Please help me up, thank you.

2006-11-22 14:58:50 · 9 answers · asked by evolutionf330q 2 in Engineering

0 ⤊

Flooding experiences anyone?

Flooding in a way of natural disaster. This is for a school project. Thanks.

2006-11-22 14:56:10 · 2 answers · asked by Anonymous in Earth Sciences & Geology

3 ⤊

math problem! probability and combinations question?

to play super lotto 6/49, a person chooses 6 numbers out of a possible 49. the lottery corporation then randomly chooses 6 numbers as well. how many possible six-number sets can be chosen by the lottery corporation that match exactly 4 out of the numbers that you choose? show your solution.

2006-11-22 14:50:28 · 2 answers · asked by rod_dollente 5 in Mathematics

3 ⤊

Help with the IEEE?

What is the ieee, what do you need to be to join it, what training is required, what courses are needed in college, what occupations are they involved with, what they may be called to do, thank you for your time.

2006-11-22 14:43:58 · 1 answers · asked by Anonymous in Engineering

1 ⤊

DNA code = TACTTACCGAGATTCTTGTTTATC?

What is the correct amino acid sequence for this DNA code Describe the necessary steps to arrive at the amino acid sequence and explain each in detail. Please list the mRNA sequence and amino acid sequence in the answer if you would please.

2006-11-22 14:40:43 · 3 answers · asked by James K 1 in Biology

2 ⤊

1 if x rational, 0 if x irrational?

so can someone go over all these types with me. I know there is one function that is continous at just the irrationals, then there are others that are continous when x get close to one of the numbers and the last are the ones that are continous nowhere. Can someone give intutive examples of each? Are there any more types then the ones i mention. There is none for continous on the rationals right?

Not a homework problem. Oh, and i do physics, so don't use less than sigma in the answer please... explain it intutively so i don't get a headache from the mathspeak.

2006-11-22 14:38:58 · 5 answers · asked by xian gaon 2 in Mathematics

1 ⤊

Three of the richest countries in the world occupy land in North America. Who are they?

2006-11-22 14:35:56 · 9 answers · asked by Zero M 1 in Geography

8 ⤊

Theoretically, hard drives should not work, why do they?

Within a hard drive is one or more very powerful magnets that control the movement of the heads. However, they don't erase the "magnetic data". Also, hard drive platters are made from stainless steel (which is non-magnetic). So how is magnetic data stored on non-magnetic material? And why are there incredibly stong magnets used internally within a hard drive? I am highly trained in electronics. Most of my electronics instructors would blame it on FM ("Freaky Magic"). Does anybody have a better answer. I'm close to believing in alien technology!

2006-11-22 14:31:28 · 9 answers · asked by ItsThatSimple 3 in Engineering

0 ⤊

use half angle indentities and the fact that sin(pi/6)=1/2 to find cos(-pi/12) and sin (-pi/12)?

2006-11-22 14:30:10 · 3 answers · asked by hope 1 in Mathematics

1 ⤊

I want to glue candies on styrophone tree I need a non toxic glue to use?

2006-11-22 14:27:11 · 4 answers · asked by prisca 2 in Chemistry

0 ⤊

Quadratic Equation?

- 8 +- sqrt(28) / 6

2006-11-22 14:27:06 · 6 answers · asked by jeffeh_munro 1 in Mathematics

0 ⤊

Why does Venus rotate so slowly?

2006-11-22 14:25:04 · 6 answers · asked by fresh2 4 in Astronomy & Space

8 ⤊

What are sea monkies?

2006-11-22 14:23:05 · 5 answers · asked by Anonymous in Zoology

0 ⤊

is an oc12 a point to point circuit?

2006-11-22 14:23:02 · 1 answers · asked by barbara b 1 in Engineering

1 ⤊

What waas the Michelson-Morley experiment?

2006-11-22 14:20:35 · 7 answers · asked by Parth 1 in Physics

0 ⤊

Solve. x^2 - 5x - 3 = 0?

Solve.
1. x^2 - 5x - 3 = 0

Solve.

2. x^2 - 10x + 9 =0

2006-11-22 14:18:25 · 15 answers · asked by George F 1 in Mathematics

6 ⤊

Can anyone help me with a complicated math problem?

The math problem is 7 6 = 4 2. You can't add any symbols to it. You can use powers because that isn't using symbols. I can't seem to figure out how to make it work out. Please help!!!!

2006-11-22 14:16:58 · 16 answers · asked by Christina F 1 in Mathematics

0 ⤊