Biology - April 2007

Several times i used to wonder 'how this body with various physiological and psychological/intellectual faculties take birth on this earth with no connections, batteries, chips etc as we find it robots? This is my genuine doubt. Kindly enlighten me?

2007-04-24 19:53:27 · 7 answers · asked by nagarajan s 4

they serve no purpose...

2007-04-24 19:45:27 · 7 answers · asked by Anonymous

i really need to know this :) kthanksss

2007-04-24 19:35:03 · 5 answers · asked by Anonymous

please.... help!!! PLEASE>>>>

2007-04-24 19:18:57 · 3 answers · asked by jaw_fil 1

2007-04-24 18:50:25 · 15 answers · asked by dee 1

chromosomes that carry genes for the same traits.

chromosomes that determine the sex of an individual.

a pair of chromosomes that together carry all the genes of the individual.

chromosomes that are together in a gamete.

2007-04-24 17:57:23 · 1 answers · asked by Anonymous

in a monohybrid cross the parents have all the same traits.

in a dihybrid cross, the parents have two traits that are the same.

in a monohybrid cross, the parents differ in one trait. In a dihybrid cross, they differ in two traits.

in a monohybrid cross, the parents have one trait that is the same, and in a dihybrid cross the parents have two traits that are the same.

2007-04-24 17:54:56 · 1 answers · asked by whatsinaname07 1

A couple has two kids. One kid has albinism and one is normal. What genotype pair can the parents NOT be? A=normal and a=albinism.


Aa x Aa

Aa x AA

Aa x aa

All of pairs could produce both normal and albino kid?

2007-04-24 17:50:20 · 5 answers · asked by Anonymous

only S

s only

half of gametes will be SS and half will be ss

half of gametes will be S and half will be s

2007-04-24 17:48:07 · 3 answers · asked by Anonymous

heterozygous with dominant phenotype

homozygous with dominant phenotype

homozygous with recessive phenotype

one that has a genetic disease.

2007-04-24 17:46:19 · 1 answers · asked by whatsinaname07 1

proposed a mechanism by which species could change over time.


proposed that both males and females contribute to the traits of an offspring.


proposed that proteins are constructed under the direction of DNA


proposed a mechanism to explain how traits are inherited.

2007-04-24 17:42:41 · 3 answers · asked by whatsinaname07 1

alleles of a particular gene sort independently to the gametes.


the alleles of different genes sort independently to the gametes.


the alleles of a particular gene sort together to the gametes.


the alleles of different genes sort together to the gametes.

2007-04-24 17:40:45 · 2 answers · asked by Anonymous

which best fits?


a single variety of a strain is self-crossed.

two varieties which vary in only one trait of interest are crossed.

only one generation of offspring is observed.

offspring from a self-pollinating plants are crossed back to the parental plant.

2007-04-24 17:38:19 · 1 answers · asked by whatsinaname07 1

2007-04-24 17:35:33 · 2 answers · asked by Anonymous

2007-04-24 17:31:04 · 10 answers · asked by Mike J 1

Normal 5'AUGCCAGCCAGCCCUUCCAGA3'
Abnormal 5'AUGCCAGCCGCCCUUCCAGA 3'

point missense, point nonsence, frame shift insertion or frame shift deletion?

2007-04-24 17:29:04 · 2 answers · asked by Anonymous

Is this right?
mRNA transcript is made; RNA polymerase attaches to DNA; ribosome attaches to mRNA

2007-04-24 17:22:03 · 2 answers · asked by Anonymous

2007-04-24 17:13:54 · 1 answers · asked by me s 1

What different between A, AB, O and B?

2007-04-24 17:02:13 · 4 answers · asked by Tintun O 1

2007-04-24 17:01:03 · 4 answers · asked by me s 1

2007-04-24 16:59:13 · 1 answers · asked by me s 1

This is from my textbook... Fluidity arises because lipids can move laterally; mosaic refers to the irregular arrangement of proteins through out the lipid bilayer.

Please help explain to me, the explanation above, in simple English because my English is not very good and I cannot digest the explanation... Thank you^^

2007-04-24 16:44:27 · 3 answers · asked by NG Yut Sei 1

Well, im not white and not black but I have been living in Northern Minnesota for all my life. It comes to a thing about evolution how different people have different skin, whites live in the north, dark in the south, so ect...

My dad has tanned skin and so does my mother but shes has a little white skin. Every year or so I have been previous tan, but my skin is turning white. I have white skin all over my arms, and legs, toes.

So heres the question, Am I evolving and turning white skin?

btw I heard that white people that live in the south graduallly turn dark to adapt to the area.

2007-04-24 16:36:01 · 3 answers · asked by Anonymous

Why are producers the first trophic level to benefit from the activity of decomposers?


this is the only question on my biology worksheet that i need help with. thanks to everyone who took the time and effort to help me!

I just have one more thing to ask, my teacher likes the answers in 2 sentences or less, so if you can, please make it in 2 sentences or less =)

THANK YOU SOOOOO MUCH!

2007-04-24 16:20:07 · 2 answers · asked by Anonymous

2007-04-24 16:15:00 · 6 answers · asked by svdfadanvis 1

2007-04-24 16:07:39 · 2 answers · asked by isranirockstar 2

I know that our bodies are comprised of proteins, lipids (fats) amd water, but how come I get so thirsty? Wouldn't my body soak up water in the tub?

2007-04-24 16:04:55 · 8 answers · asked by LadeeBug Buddha 3

this has to do with the excretory system...it is part of a crossword and i looked on wikipedia and i googled it, but i couldn't find it.

2007-04-24 15:38:17 · 2 answers · asked by Anonymous

2007-04-24 15:32:43 · 10 answers · asked by Anonymous

i need it now for the last biology HW asinment

2007-04-24 15:21:31 · 2 answers · asked by Lewis N 1