Biology - January 2007

So can you honestly prove to me that man evolved from a monkey fish frog muntant thing to become man, show me proof, or can you?

2007-01-02 15:33:54 · 9 answers · asked by Anonymous

2007-01-02 15:20:43 · 7 answers · asked by Anonymous

Which of the following is the term for a human cell that contains 22 pairs fo autosomes and two X chromosomes?
a. an unfertilized egg cell
b. a female somatic cell
c. both a and b

2007-01-02 15:19:38 · 3 answers · asked by lauren u 1

Like, a cat and a bat are nocturnal and we are the opposite. What's the term for those that reside in the daytime?

2007-01-02 15:17:27 · 15 answers · asked by Smo 4

2007-01-02 15:16:55 · 7 answers · asked by Zoid00 2

okay, so my biology teacher gave us this sheet and it explains the DNA replication. it says..
3' 5'
CGCTACTCTACGGCACCCAATATTACGTAGTCCTTGGGGGTTTAACGGTACCCAGTATCCGGCCT
GCGATGAGATGCCGTGGGTTATAATGCATCAGGAACCCCCAAATTGCCATGGGTCATAGGCCGGA
5' 3'

and the assignment is to create a DNA replication study sheet using this sequence.
and i am confused.
please help!!! i will be greatly obliged.
thanks.

2007-01-02 15:14:02 · 2 answers · asked by whattup. 1

2007-01-02 15:13:18 · 6 answers · asked by Anonymous

is oil an example of a saturated fat???
thanks

2007-01-02 15:06:16 · 2 answers · asked by hondarider400at 3

i have a worksheet due tomorrow and it has 100 questions on it i cannot find about 10 of them in this one section can anybody help

classify the following as a carb---lipid--- or protein

bacon grease
lipase
egg white
veatable oil
cellulose
DNA
RNA
bees wax
thanks

2007-01-02 14:34:25 · 4 answers · asked by hondarider400at 3

Why is there a higher chance of having an abnormal child if the parents are brothers and sisters?

2007-01-02 14:23:04 · 7 answers · asked by Anonymous

There are two major products of photosynthesis—water and organic substances such as glucose. How would the presence of DPIP (2,6-Dichlorophenol-Indophenol, electron accepting compound) affect the production of oxygen during the light reaction? How would the presence of DPIP affect the production of organic product during the dark reaction?


What role did another artificial electron acceptor, ferricyanide, play in elucidating the process of photosynthesis?

2007-01-02 14:18:52 · 2 answers · asked by dthepoolpro 1

I want to know is anyone knows any of these science questions?

1. How many chromosomes are in a human?
2. How many cromosomes are in an egg or sperm?
3. How many chromosomes are in a potato?
4.How many cromosomes are in a potatoes sex cells?
5. How many cromosomes are in a Chimpanzee?
6. How many chromosomes are in a chimpanzee's sex cells?

2007-01-02 14:13:04 · 4 answers · asked by HOTTIE 101 2

are Zygotes mutlicellur, diploid or gametes?

2007-01-02 14:10:47 · 4 answers · asked by Anonymous

2007-01-02 13:59:06 · 6 answers · asked by Anonymous

When I say "teh importance of electrons in photosynthesis" I know electrons are important for basically everything because they consist in every piece of matter. But, Why is it important for sunlight to excite the elctrons from H20... How do the H ions have an effect on photosynthesis? I understand the process, I just don't know the extended mechanics of it! THANKS FOR ANSWERING! YALL ARE DA BEST!

2007-01-02 13:58:22 · 4 answers · asked by Upon this rock 3

When I say "teh importance of electrons in photosynthesis" I know electrons are important for basically everything because they consist in every piece of matter. But, Why is it important for sunlight to excite the elctrons from H20... How do the H ions have an effect on photosynthesis? I understand the process, I just don't know the extended mechanics of it! THANKS FOR ANSWERING! YALL ARE DA BEST!

2007-01-02 13:57:39 · 1 answers · asked by Upon this rock 3

2007-01-02 13:54:48 · 2 answers · asked by iqbalkhanayesha 2

2007-01-02 13:35:39 · 7 answers · asked by chandrakant r 1

2007-01-02 13:04:47 · 22 answers · asked by Anonymous

I dont understand any of it!

2007-01-02 12:59:13 · 3 answers · asked by DramaKid2010 2

A)Proteins
B)Pheontypes
C)Alleles
D)Pedigrees

2007-01-02 12:58:32 · 1 answers · asked by ▐▀▀▼▀▀▌ ►that guy◄ ▐▄▄▲▄▄▌ 5

2007-01-02 12:58:01 · 7 answers · asked by Kabuki Anabuki 1

Can you complete the sentence for me?

2007-01-02 12:41:45 · 9 answers · asked by ▐▀▀▼▀▀▌ ►that guy◄ ▐▄▄▲▄▄▌ 5

2007-01-02 12:28:36 · 0 answers · asked by Mickey 1

does yeast need to be in an liquid solution to work? I mean can it work if mixed in with a solid compound like pure sugar? rather than diluting the sugar first in water then addin in the yeast

2007-01-02 11:54:06 · 3 answers · asked by Flaming Pope 4

This is my science extra credit and im trying to get a masters....

2007-01-02 11:48:37 · 4 answers · asked by Anonymous

Also what are finger nails made of?.....

2007-01-02 11:45:47 · 5 answers · asked by Anonymous

2007-01-02 11:37:24 · 3 answers · asked by glossykisses16 1

I have a cell project due tomarrow and I need help!!! I have to compare the cell to something like a house but I cant do a house because that was example the teacher used. I need to tell what everything is in it....Like for the nucleas, vacuoles, cell membrane, etc....Any ideas for the project????

2007-01-02 11:35:49 · 6 answers · asked by Anonymous

2007-01-02 11:35:40 · 5 answers · asked by knada242 2