Biology - October 2006

2006-10-01 17:29:41 · 7 answers · asked by Asilos Magdalena 1

list 9 body systems
the organs that belong to each

2006-10-01 17:28:36 · 7 answers · asked by Anonymous

1 real life example

2006-10-01 17:26:05 · 5 answers · asked by Anonymous

1 real life example

2006-10-01 17:24:55 · 0 answers · asked by Anonymous

2006-10-01 17:03:25 · 1 answers · asked by :) 2

A. obtain and process energy
B. convert genetic information into proteins
C. Keep certain biochemical reactions separate from one another
D. both a and b
E. a, b, and c

2006-10-01 16:22:09 · 5 answers · asked by texascg008 2

2006-10-01 16:20:09 · 12 answers · asked by Adnan 1

How does ATP give energy to the reactions it helps with?

2006-10-01 16:18:44 · 2 answers · asked by Adnan 1

UCUAUGUUUCACAGAGGGAAACCCUAACCC (wildtype)

UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)

Using the above sequence, explain what effect the mutation has on the protein that will be translated. (Module 10.8)



1. complete change in amino acid sequence after the mutation

2. prematurely stop the translation of the protein

3. no effect

4. single amino acid change

2006-10-01 16:16:25 · 4 answers · asked by Anonymous

2006-10-01 15:27:39 · 11 answers · asked by soulvendor2002 2

A fetus is not part of a womans body. It has its own DNA and organs. An arm.leg,foot are body parts a baby is its own body with its own parts. If the baby is a boy how can this woman have a penis as a body part?? A fetus well enough along can survive without its mother and the mother can survive without the baby. A fetus is a seperate individual with a seperate DNA.

2006-10-01 15:15:41 · 4 answers · asked by TrofyWife 4

This is a perposterous position! What baby can survive on its own outside the mothers womb? Every baby will die without assistance from someone else. People who hold this position need to take a boat load of thinking pills!

2006-10-01 15:05:09 · 16 answers · asked by nobodiesinc 1

when i ask for foods, i mean like specific products and food labels.

2006-10-01 15:01:00 · 2 answers · asked by pakiprincess920 2

-How might the shape of cheek cells relate to their function?
-What chemical substance do we obtain from potatoes when we eat them?

2006-10-01 15:00:41 · 1 answers · asked by yhayyhaylingling 2

SKIN CELLS....NOT SKIN when eever I ask a question about my project, somebody answers about skin, I need to find a picture of a specific skin cell.

2006-10-01 14:47:02 · 4 answers · asked by Kedah<3 3

2006-10-01 14:36:40 · 9 answers · asked by Tiana 2

I'm not sure about this question, i hope you can help....

Q. (a) A researcher measured the concentrations of oxygen in the air around some cells placed in strong sunlight. He found that as time passed the oxygen concentration continued to increase. Explain this observation.

Q. (b) The researcher then changed the light intensity until it was observed that the concentrations of oxygen and carbon dioxide in the surrounding air remained constant.

(i) Explain this observation
(ii) Was the light intensity increased or reduced by comparison with the conditions in Part (a) of this question?

thanks heaps!! :-) I appreciate you takin' the time.

2006-10-01 14:12:44 · 3 answers · asked by Anonymous

2006-10-01 14:02:45 · 10 answers · asked by princess 1

It seems that flys always go away at night and stop bothering everyone. Where do they go or where do they sleep? Any information will help. Thank you.

2006-10-01 13:56:33 · 8 answers · asked by Robbyz3 2

When it rains water falls on the ground and swallowed by the roots of a tree, but how does that water gets to the top of the tree?

2006-10-01 13:03:52 · 5 answers · asked by Anonymous

2006-10-01 12:45:06 · 9 answers · asked by w_explorer 1

I'm not ashamed that my origin is monkey.I'm not better than monkeys. many people knew it even before Darwin.
There are also scientific research & proofs that some readers of this question can provide you in
their answers. What do you think ?

2006-10-01 12:34:38 · 11 answers · asked by opal 1

Mine is black with a yellow stripe going down the middle of it. With Yellow stripes at the top of it.

2006-10-01 12:01:03 · 2 answers · asked by falloutgirl349 1

I need to design an experiment to test the effects of air pollution on plants. And I need to Include a control. Any ideas??

2006-10-01 11:46:44 · 6 answers · asked by Josh 2

2006-10-01 11:44:29 · 6 answers · asked by Pietro M 2

2006-10-01 11:36:42 · 3 answers · asked by Anonymous

What is the purpose of finger & toe nails? The only purpose I can see is for the protection of the tips of fingers & toes. But why are they there? What causes them to grow?

2006-10-01 11:34:23 · 5 answers · asked by jbax7771 1

and what does it mean when someone cant cry and shed tears? is there something wrong with thier tear ducts (sorry spell)

2006-10-01 11:06:45 · 9 answers · asked by allgiggles1984 6

2006-10-01 10:39:58 · 9 answers · asked by soulvendor2002 2

I had a dream and "Me and my people" were doing that as we said thanks out loud too, I don"t think of this in supersticious terms either

2006-10-01 10:31:08 · 1 answers · asked by Anonymous