Using the above sequence, explain what effect the mutation has on the protein that will be translated?

Question

UCUAUGUUUCACAGAGGGAAACCCUAACCC (wildtype)

UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)

Using the above sequence, explain what effect the mutation has on the protein that will be translated. (Module 10.8)



1. complete change in amino acid sequence after the mutation

2. prematurely stop the translation of the protein

3. no effect

4. single amino acid change

Answer 1

Work it out yourself you lazy basta*d.

PS there's a premature stop at UGA.

Answer 2

First of all locate the start codon (AUG) which encodes methionine.
So the reading frame is as follows in the w..t
AUG UUU CAC AGA

Now examine the bottom sequence until you see a change.

It looks like in the 4th codon, AGA has changed to UGA. It's a simple A to U transversional mutation. You now check the genetic code table to see what amino acid change will occur. It's actually changes an Arginine to a Stop codon.

So the answer is (2) prematurely stop the translation of the protein, since the protein will be truncated to only 3 amino acids (which is unlikely to be stable.)
This is a severe mutation and probably in fact a null mutation.

If you work out several problems like this you will get better at it, keep at it because the study of DNA and genetics is fascinating stuff!

Answer 3

Substitution. it would desire to alter one amino acid, yet something would desire to be an identical. to boot or deletion, the completed sequence it shifted, so there's a bigger result on the protein synthesized.

Answer 4

it would be the single amino acid change