mRNA sequence???

Question

This is an mRNA sequence for the name of a protein found throughout your body:

5' C U A C C U C A G A U U C G C C U A C C U 3'

1. What is the DNA sequence that encodes for the word for this protein?

2. What is the protein?

3. Explain how, in your answer to question 1, you obtained the sequences listed from the RNA sequence.

Answer 1

OK, simple...this is how I remember it...
Ants are tiny... and... Car needs Gas...
Well, the A in ants is Adenine, the t in tiny is Thymine, Adenine always matches with Thymine

Also, the C in car stands for Cytosine while the G in gas stands for Guanine, Cytosine always matches with Guanine
(A-T) (C-G)

However, there are U's in the sequence, which stand for uracil and take the place of T(Thymine)...in a DNA sequence there is no uracil(U) so always replace it with a A!
so...

Q.1-GATGGAGTCTAAGCGGATGGA

Q.2-ZINC FINGER PROTEIN

Q.3-OK, Adenine always pairs w/ Thymine in a DNA sequence while Cytosine always pairs w/ Guanine. So, a C in a mRNA seuence would change to a G and vice versa! Also, since Adenine always pairs w/ Thymine, an A would switch to a T. However, the U(uracil) takes the place of Thymine in a mRNA sequence so to get a DNA sequence simply switch it back to a T...and remember, A-T so the T(Thymine) would match with the A(Adenine)

REMEMBER:
(A-T) while (C-G)

By the way, I couldn't find the whole mRNA sequence or RNA sequence in the human genome project either(the identification of all DNA sequences in the body) but a sequence does give the Zinc Finger Protein!

Answer 2

Just searched the human genome for this sequence and found 0 matches. I tried searching with a shorter sequence, "GCCTACCT" and found a few matches. One is to a zinc finger protein. You can search too in case your sequence is different from the one in your question.

Answer 3

this is somewhat common fairly. You be conscious the T-A, G-U rule. In DNA, G constantly couples with C in maximum situations of thumb and T with A. In RNA C is replaced by skill of u.s. that G couples with U in RNA. The sequence you gave consequently interprets to: ATGUUAGATGUUAUUAAGGUTAA (mRNA sequence) TACGGTCTACGGTAGGTTCCGATT (DNA sequence)

Answer 4

Wouldn't it be funny if you teacher was a member of yahoo answers?

Answer 5

1.) Amino Acid
2.) Amino Acid
3.) I used my head