Why is DNA replication said to be continuus for one strand but discontinuous for the other strand?

Answer 1

DNA synthesis proceed in 5'->3'direction.bcoz 2 strans od dna are antiparallel.one strand is synthesis in short fregments called okazaki fragments.leading strand or continous strand is synthesis in 5'->3' direction in the same direction of replication fork movement.the discontinious or lagging strand is synthesis in 5->3' direction that contains okazaki fragments,in the direction opposite to the fork movement.thats why replication is continious and discontinious.

Answer 2

You need to think about the directions of the two strands of DNA, and particularly about the direction in which DNA polymerase synthesizes new DNA using a DNA template.

Almost any cell biology and genetics text book will have a very nice explanation and description of the continuous and discontinuous synthesis of DNA along the leading and lagging strands, respectively.

Answer 3

Because DNA polymerase can work only in one direction: 3'--->5' of the new strand.

Thus replication the other strand, called the lagging strand, requires it to make short fragments, called okazaki fragments, that are later combined by an enzyme called DNA ligase.

Answer 4

It's quite simple really. You apply the T-A, G-U rule. In DNA, G always couples with C as a rule of thumb and T with A. In RNA C is replaced by U so that G couples with U in RNA. The sequence you gave therefore translates to: ATGUUAGATGUUAUUAAGGUTAA (mRNA sequence) TACGGTCTACGGTAGGTTCCGATT (DNA sequence)