Given the DNA sequence TACGGGGTCAAAAGGCCGATC, what would the complementary mRNA sequence be?

Question

The tRNA anticodons? What is the sequence of the protein encoded by this gene?

Answer 1

Well, RNA has to match up correctly with DNA.

in DNA, A matches up with T, and G matches up with C.

And RNA has Uracil instead of thymine. So G matches up with C, and U matches up with A.

That gies us:
AUGCCCCAGUUUUCCGGCUAC

Which sounds a lot like a guy falling off of a cliff, screaming while eating peanut butter.

So the mRNA is the above, and the tRNA is the compliment of THAT, which would be basically the DNA sequence (except that DNA has Thymine bases, and tRNA has uracil bases). So replace the T in the DNA with U, and that's your tRNA.

To help you visualize:

DNA -> mRNA -> tRNA

As for the sequence of the protein, that you'll have to look up by yourself.

Answer 2

its 5'-TACGGGGTCAAAAGGCCGATC-3' rite?
then the mRNA sequence is
3'-AUGCCCCAGUUUUCCGGCUAG-5'
reading from 5' to 3' direction, the tRNA then produces a protein with tis sequence: N-Asp-Arg-Pro-Phe-Asp-Pro-Val.....-C
there's no stop codon, so the mRNA sequence is not complete, and the protein sequence is also incomplete. note for the protein, N denotes the amino end while the C denotes the carboxyl end

Answer 3

The complementary mRNA codons are AUGCCCCAGUUUUCC CCGGCUAG (A from DNA matches with U from RNA, C matches with G, G matches with C, and T matches with A) Good luck.

Answer 4

i think the information given by brian l is correct. otherwise i would have been the first one to explain it the same way.

Answer 5

mrna: AUGCCCCAGUUUUCCGGCUAG
trna is the same as the DNA, but using rna bases
so: UACGGGGUCAAAAGGCCGAUC