can somebody describe transcription/translation in lamens terms?

Question

please explain everything, but also what happens after its a protien (DNA>RNA>polypeptide>protein>.........)

Answer 1

Ok, so DNA is divided into 23 HUGE molecules called chromosomes in every cell of your body. Of the 23, #1- #21 we call autosomes, and the last 2 (X and Y) are sex chromsomes. Every cell has a PAIR of all 23, with one set coming from each of your parents.

So DNA is a huge molecule made up repeating units of nucleotides, each of which contains a nitrogenous base (A, G, C, or T). So if you stretched out a chromosome so the DNA was arranged in a straigt line, you might see something like this:
ATTCCCGAGGTAATAAATCTTCGAGTCGTAG (of course in reality it's much much longer).

Now, some parts of a DNA molecule, called genes, lead to some kind of end product beyond DNA which will have some kind of function. These end products are called proteins. So how do we get from DNA to proteins? The molecule mRNA (which is structurally slightly similar to DNA) is the intermediate. It carries this code from DNA to the protein factories, where the protein product is made. That's why it is called messenger RNA.

Transcription is the name of the process which mRNA is synthesized based on DNA. Remember that DNA molecules can be thought of as a sequence of nitrogenous base molecules consisting of A, G, C, and T. Well, each base in DNA codes for a complement base in mRNA, except in mRNA the bases are A,G, C, and U. Enzymes in transcription (called RNA polymerases) read this DNA template, and create a mRNA molecule based on this template. The mRNA molecule then binds to a protein factory called a ribosome where in similar fashion, a protein will be synthesized based on the mRNA sequence.

This is called translation. In translation, the ribosome reads the mRNA template, and creates a protein based on it. The ribosome has a reading frame of THREE RNA bases, so ever group of 3 consecutive bases in an mRNA codes for one protein unit, called an amino acid. So think of it this way, an RNA that looks like this BBBBBBBBBBBB (B for base) will be read in groups of three like this: BBB - BBB - BBB - BBB. That sequence will translate to amino acids like this: A - A - A - A. And every combination of BBB (AUG, ACG, CCG, GUA, etc.) codes for one of the 20 amino acids that exist. These amino acids are bound together to form functional proteins!

The next part of this is getting from a linear protein molecule, like A-A-A-A-A-A-A-A-A (where A is an amino acid) to a functional unit is protein processing. When the protein leaves the ribosomes, it is picked up by other organelles in the cell called the endoplasmic reticulum and the golgi apparatus. In these organelles, the protein interacts with other proteins, and is able to shape itself into a functional protein, when afterward it is used in the following ways:

(1) somewhere inside the cell (for DNA replication, or for a metabolic process like cellular respiration, or for the cell's skeleton called the cytoskeleton)

(2) or embedded into the cell membrane (where it can serve as a signaling molecule to communicate with other cells or as a transporter of molecules into and out of the cell) or

(3) it could be secreted into the cell's environment (like a cell of a gland secreting a hormone, or an osteoblast that builds bone and secretes collagen to build the matrix of all of your bones).

It's a complicated process, but it's the CENTER of life, this is what gives us life. Happening in every one of us, in every one of our cells!

Answer 2

study Cosmic set off by skill of Colin Anton Wilson, he provides an exciting attitude on the do away with darkness from. particular, that's a actual enterprise and various of different politicians are contributors. The Illuminati is an occult enterprise and has a sequence of instructions and grades, such as that interior of Freemasonry. It can provide promise of the communication of deep occult secrets and techniques interior the better ranks.

Answer 3

Transcription is form DNA to mRNA. Translation is from mRNA to tRNA to proteins. How much more would you like it explained?