Melanin-a type of pigment or coloring
2007-01-04 07:05:34 · 3 answers · asked by who am i 2 in Science & Mathematics ➔ Biology
Melanin is a protein
2007-01-04 07:12:32 · update #1
melanin is a type of protein-function=pigment!!!!!!!!! dude i got this from my teacher or is she dumb?
2007-01-04 07:36:25 · update #2
Melanin is not a protein, so the question cannot be answered
The only connection between melanin and protin is that some forms of melanin are derived from the amino acid tyrosine and other forms attach to proteins. To see the structure, check out the site listed
2007-01-04 07:09:43 · answer #1 · answered by Anonymous · 1⤊ 0⤋
Your mRNA sequencd is actual. the entire concept is that when transcribing, Adenine is oftentimes transcribed to supply uridine and guanine is transcribed to cytosine and vice versa in spite of the incontrovertible fact that it form of feels you ignored one base through fact your DNA strand replaced into 24 base whilst your mRNA replaced into 23 base. So the mRNA strand is AUGCCAGAUGCCAUCCAAGGCUAA As for the sequence of amino acid you will choose the genetic code to be waiting to translate the mRNA to a chain of protein, and by probability I even have one with me good now. So the sequence of amino acid would be Methionine, proline, Asparagine, alanine, isoleucine proline, glycine, end. continuously remenber that methionine is a start up codon. wish it helps
2016-12-12 03:43:37 · answer #2 · answered by ? 4 · 0⤊ 0⤋
No, you're incorrect. Melanin isn't a protein.
2007-01-04 07:22:30 · answer #3 · answered by hcbiochem 7 · 0⤊ 0⤋