why is the letter "e" inverted under the microscope?

Answer 1

If we view this letter "e" with the microscope at 40X, 100X, and

400X, the image appears to be inverted, as happens with most compound

microscopes. The complete letter "e" is visible at 40X and 100X, but not at 400X.

The field of view remains the same, but the image is magnified and only a portion of

the letter "e" is visible.

Answer 2

It will be inverted. The lense will focus the light to a single point and after that point (the image will be inverted. It is the same reason most begining students have trouble moving the objective tray the right direction to find things. Any object on the left of the field of view that you want to move to the center actually is on the right so the tray needs to be moved more to the left. Everything is backwards. Check out the link for a more complete answer.

Answer 3

Deoxyribonucleic acid (DNA) is a macromolecular chain of nucleotides that serves as a basic carrier of genetic information and is able to self-replicate. DNA can be represented as a sequence of nucleotide bases. DNA sequences are typically from thousands to millions of bases long. DNA usually consists of two strands of complementary nucleotide sequences that are base paired to each other. DNA in humans forms a linear chain, but DNA can also form a circular molecule. A hypothetical double-stranded DNA molecule can be represented as

ACGTGGTAGAGACCCTGTGTGATAGACCACGGGTA
TGCACCATCTCTGGGACACACTATCTGGTGCCCAT

As A pairs with T and C pairs with G and vice versa, the above molecule can be represented as \smallskip ACGTGGTAGAGACCCTGTGTGATAGACCACGGGTA \smallskip Here A - Adenine, C - Cytocine, G - Guanine, T - Thymine. Thus a DNA molecule can be thought of as a string over an alphabet of four characters {A, T, C, G} (nucleotides). We give below brief definitions for some more important terms in molecular biology

Answer 4

This is actually basic. It's to long to give you an easy answer to something so easy so here you go.