Science & Mathematics - 1 October 2006

2006-10-01 17:02:38 · 6 answers · asked by Anonymous in Other - Science

Java

2006-10-01 17:02:23 · 3 answers · asked by randollas 1 in Mathematics

I'm repairing a Switching Power Supply. It has HIGH voltage DC circuit @ 320VDC. There are two "chopper" supplies. The 12VDC is the primary output. The 20VDC is for the chopper circuit, a TL494 chip. All semi test fine with Ohm meter. There is no Vcc on the TL494 when plugged in so the chopper never runs. I can "jumpstart" the TL494 by momentarily applying external 9VDC to Vcc and Grnd. Supply runs fine w/o battery after that until unplugged.
Brand: HANNY Model: FX-101
No schematic or tech support available. The problem is the initial startup. How does HANNY design the startup for their switching supplies? Is it a mini linear supply? A starting resistor? A starting cap? Self resonance? What do I look for? Checked power resistors, all in spec. What can I look for? Supply is only five months old, likely not dried caps. Ideas?

2006-10-01 17:01:22 · 3 answers · asked by hack_ace 4 in Engineering

Would a magnetic compass work on the moon?

2006-10-01 16:57:36 · 2 answers · asked by claymore 3 in Other - Science

60 degrees. Which projectile has the lower speed at max altitude? what is the ranges of projectiles? what is the acceleration of projectiles while in flight?

2006-10-01 16:55:06 · 7 answers · asked by Anonymous in Physics

A motorboat goes 8 miles upstream in the same amount of time it is able to go 12 miles downstream. The river flows at 3 miles per hour, what is the speed of the boat in still water.

2006-10-01 16:53:37 · 4 answers · asked by Denise L 1 in Mathematics

Two separate but similar oils of wire are mounted close to each other. The first is connected to a battery and has a direct current flowing through it. The second is connected to a galvanometer. How does the galvanometer respond when the switch in the first circuit is closed? How about after being closed when the current is steady? And what about when the switch is opened?


*This is for my physics class.....I'm SO confused! If someone could explain it in easily-understandable terms, i would greatly appreciate it!

2006-10-01 16:51:20 · 4 answers · asked by MegN 1 in Physics

How much power does it take? What components does it use? Can you buy just the vibrating portion? How much does it vibrate/move?

2006-10-01 16:50:33 · 1 answers · asked by ee 2 in Engineering

82% of items are regular and 77% of regular items are of the top quality. What is the probability that a randomly picked regular item is of the top quality?

Please show all work!

2006-10-01 16:48:29 · 4 answers · asked by Anonymous in Mathematics

Got 'cha there!

2006-10-01 16:48:14 · 11 answers · asked by Saffernellie 6 in Other - Science

mechanical seal

2006-10-01 16:44:01 · 7 answers · asked by madad5757 1 in Engineering

A grasshopper jumps 1.40 m from rest, with an initial velocity at a 47.0° angle with respect to the horizontal.
(a) Find the initial speed of the grasshopper.
m/s
(b) Find the maximum height reached.
m

i dont want the answer obviously, just a step in the right direction! because my friend has NO IDEA how to do it (and either do i because i havent taken physics yet lol)

Thank u!!!!

2006-10-01 16:42:16 · 2 answers · asked by ? 4 in Physics

Illuminate Me.

2006-10-01 16:39:07 · 1 answers · asked by Shun John 1 in Earth Sciences & Geology

Take a square with side length x. Connect the midpoints of each side to their non adjacent verticies so that an octagon forms inside the square. What is the area of the octagon in relation to the original square?

2006-10-01 16:38:36 · 3 answers · asked by DougieWang 1 in Mathematics

which of these is a proper Fraction?
15/2 6/6 4/17 11/10

2006-10-01 16:38:11 · 2 answers · asked by craig s 1 in Mathematics

2006-10-01 16:36:47 · 5 answers · asked by Anonymous in Astronomy & Space

2006-10-01 16:33:11 · 5 answers · asked by Anonymous in Astronomy & Space

I need the sentence. Geography is the study of________.

2006-10-01 16:32:02 · 7 answers · asked by Anonymous in Geography

2006-10-01 16:26:27 · 9 answers · asked by Anonymous in Chemistry

Bar Mitzvahs, a lot of people are doing it and it is realy funny. Before i start doing it I want to make sure that it is (somewhat) safe.
Be honest, no rapists

2006-10-01 16:23:07 · 8 answers · asked by myaspan 2 in Chemistry

i) 50.0 newtons at 45 degrees north of east and ii) 25.0 newtons at 30 degrees south of east. what is the magnitude and angle of resultant relative to the easterly direction?

2006-10-01 16:23:01 · 2 answers · asked by Anonymous in Physics

Find an equation of a line that passes through the point (4,2) and is perpendicular to the line with the equation

5X-4Y=8

My teacher marked it wrong on my test, can someone answer so i can see if I actually got it right?

2006-10-01 16:22:46 · 7 answers · asked by beast 1 in Mathematics

A. obtain and process energy
B. convert genetic information into proteins
C. Keep certain biochemical reactions separate from one another
D. both a and b
E. a, b, and c

2006-10-01 16:22:09 · 5 answers · asked by texascg008 2 in Biology

lost wallet in house or in front of house

2006-10-01 16:20:32 · 11 answers · asked by zero2_k 1 in Other - Science

2006-10-01 16:20:09 · 12 answers · asked by Adnan 1 in Biology

Find the sum and product of the roots of 6x^3 - 9x^2 + x = 0

Please help by showing work.

2006-10-01 16:19:44 · 6 answers · asked by elguapo_marco_2008@sbcglobal.net 3 in Mathematics

2006-10-01 16:19:26 · 7 answers · asked by ELVIA 2 in Mathematics

How does ATP give energy to the reactions it helps with?

2006-10-01 16:18:44 · 2 answers · asked by Adnan 1 in Biology

UCUAUGUUUCACAGAGGGAAACCCUAACCC (wildtype)

UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)

Using the above sequence, explain what effect the mutation has on the protein that will be translated. (Module 10.8)



1. complete change in amino acid sequence after the mutation

2. prematurely stop the translation of the protein

3. no effect

4. single amino acid change

2006-10-01 16:16:25 · 4 answers · asked by Anonymous in Biology

2006-10-01 16:16:14 · 11 answers · asked by Anonymous in Other - Science